View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_low_62 (Length: 246)
Name: NF15789_low_62
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 51964258 - 51964467
Alignment:
| Q |
1 |
atcaatatatcagataatgattatgcataattcatgtaatgcccgtttacttggatgaaatgagaagaatcaacagagtttttataatctttctgatttc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51964258 |
atcaatgtatcagataatgattatgcataattcatgtaatgcccgtttacttggatgaaatgagaagaatcaacatagtttttataatctttctgatttc |
51964357 |
T |
|
| Q |
101 |
atttcaaaataaaaagtgaaaaactaatctcagatttcctcttcaaatgatagacaaaggctaagtgacataataataagcatgcccccactcaatcgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964358 |
atttcaaaataaaaagtgaaaaactaatctcagatttcctcttcaaataatagactaaggctaagtgacataataataagcatgcccccactcaatcgtg |
51964457 |
T |
|
| Q |
201 |
tcttgaccgg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
51964458 |
tcttgaccgg |
51964467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University