View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_low_64 (Length: 240)
Name: NF15789_low_64
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_low_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 90 - 222
Target Start/End: Complemental strand, 34619635 - 34619503
Alignment:
| Q |
90 |
agaaaacaaccaagcttgaaagtacataaaacattccttaatgtctcaataatatattctcatcaaagataatgtacctcgtcgacatctcttgccatgt |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
34619635 |
agaaaacaaccaagctttaaagtacataaaacattccttaatgtctcaataatatattctcataaaaaataatgtaccttgtcgacatctcttgccatgt |
34619536 |
T |
 |
| Q |
190 |
gtttttcacacctaggatggtaaatggtaattg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34619535 |
gtttttcacacctaggatggtaaatggtaattg |
34619503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 34619690 - 34619621
Alignment:
| Q |
1 |
tatgattatgagggctaagaaagaagataaaacgaccaagcttttcttttgaaggagaaaacaaccaagc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34619690 |
tatgattatgagggctaagaaagaagataaaacgaccaagcttttcttttgaaggagaaaacaaccaagc |
34619621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University