View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15789_low_67 (Length: 236)

Name: NF15789_low_67
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15789_low_67
NF15789_low_67
[»] chr7 (1 HSPs)
chr7 (15-220)||(45399626-45399831)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 45399831 - 45399626
Alignment:
15 taatctacacataaatccatcaactcgtaaaccaaaagaaggatctaaagaaaattgaattggttaacctcacaccaattgcaagagcacgaaaattaaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45399831 taatctacacataaatccatcaactcgtaaaccaaaagaaggatctaaagaaaattgaattggttaacctcacaccaattgcaagagcacgaaaattaaa 45399732  T
115 ggcacaagaaatcaagggcagtccaacccagaaattaaacacaacagtggttcaaccctcttttcataaaacccatgaactttaacccataaaaaggagt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
45399731 ggcacaagaaatcaagggcagtccaacccagaaattaaacacaatagtggtttaaccctcttttcataaaacccatgaactttaacccataaaaaggagt 45399632  T
215 ggctta 220  Q
    ||||||    
45399631 ggctta 45399626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University