View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_low_69 (Length: 235)
Name: NF15789_low_69
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 15002639 - 15002758
Alignment:
| Q |
1 |
ccactcctacgtatctacaaaatacacagccataattggctaattagttaaaagttttctcattctagctacttcactaataatttgtgttttaggatat |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15002639 |
ccactcctatgtatctacaaaatacacagccataattggctaattagttaaaagttttctcattctagctacttcactaataatttatgttttaggatat |
15002738 |
T |
 |
| Q |
101 |
atattaaaattaatttatct |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
15002739 |
atattaaaattaatttatct |
15002758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 119 - 222
Target Start/End: Original strand, 15002799 - 15002902
Alignment:
| Q |
119 |
cttaaccgtcgaacatttttgaaagaattttatccaatttcacatactactattgtacatacagaaatcatgcccttgttaggtccgtttggtcggaggt |
218 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15002799 |
cttaaccgtggaacatttttgaaagaactttatccaatttcacatactactattgtacatacagaaatcatgcccttgttaggtccatttggtcggaggt |
15002898 |
T |
 |
| Q |
219 |
tttt |
222 |
Q |
| |
|
|||| |
|
|
| T |
15002899 |
tttt |
15002902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University