View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15789_low_76 (Length: 222)
Name: NF15789_low_76
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15789_low_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 46873857 - 46874045
Alignment:
| Q |
20 |
ggacataccttcgatctgaagtgtccatgatacgtatgttaatgttgactaactttatgttgttttgttgctgtttaatagtggaatggtggacaagtta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873857 |
ggacataccttcgatctgaagtgtccatgatacatatgctaatgttgactaactttatgttgttttgttgctgtttaatagtggaatggtggacaagtta |
46873956 |
T |
|
| Q |
120 |
gctatgtgattcggaaggccaatacttcatggatacaaccaaaatggggtgcctcagtagtgcaattagaccctaatacttgggttctt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46873957 |
gctatgtgattcggaaggccaatacttcatggatacaaccaaaatggggtgcctcggtagtgcaattagaccctaatacttgggttctt |
46874045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University