View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1578_low_10 (Length: 207)
Name: NF1578_low_10
Description: NF1578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1578_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 46708628 - 46708457
Alignment:
| Q |
21 |
tgttggtgtattattgtactttgtttctaatatttgatgatcatttaccatttattttgatataataaataacaactagtattatgattatttaccattt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708628 |
tgttggtgtattattgtactttgtttctaatatttgatgatcatttaccatttattttgatataataaataacaactagtattatgattatttaccattt |
46708529 |
T |
|
| Q |
121 |
atttgtcttcttaacgtgtttagattgtcgactttatttgctgctaactatgtcttcacttgtaaccctttg |
192 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46708528 |
atttgtcttcttaacgtgtttagactttcgactttatttgctgctaactatgtcttcacttgtaaccctttg |
46708457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University