View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1578_low_4 (Length: 262)
Name: NF1578_low_4
Description: NF1578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1578_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 31223888 - 31224144
Alignment:
| Q |
1 |
tagtaaggtacttgtcttgtcttctcttttcaaaatcaagatacactatacggtctacgttcattcgtctctgattttatggtcacttaatttcattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31223888 |
tagtaaggtacttgtcttgtcttctcttttcaaaatcaagatacactatatggtctacgttcattcgtctctgattttatggtcacttaatttcattcat |
31223987 |
T |
 |
| Q |
101 |
tggcaatatttattaaattaacatat--gacactcacattgttgtaggtaattaaccatggaattgatgagtctacaatgaaagatgctctacaagttgc |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31223988 |
tggcaatatttattaaattaacatatatgacactcacattgttgtaggtaattaaccatggaattgatgagtctacaatgaaagatgctctacaagttgc |
31224087 |
T |
 |
| Q |
199 |
aacagaattcttcaacctccctaatgatgaaaaaatgcgcttattttctgatgatgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31224088 |
aacagaattcttcaacctccctaatgatgaaaaaatgcgcttattttctgatgatgt |
31224144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University