View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1578_low_9 (Length: 219)
Name: NF1578_low_9
Description: NF1578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1578_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 125 - 215
Target Start/End: Complemental strand, 2797048 - 2796959
Alignment:
| Q |
125 |
gaaatctaagacaacccttttggttttgcttaatgggttttcagaaaatagaagaaagatggnnnnnnnacgttgttgttgttgttggtgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2797048 |
gaaatctaagacaacccttttggttttgcttaatggg-tttcagaaaatagaagaaagatggtttttttacgttgttgttgttgttggtgg |
2796959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University