View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15790_low_10 (Length: 203)
Name: NF15790_low_10
Description: NF15790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15790_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 69 - 137
Target Start/End: Original strand, 37606024 - 37606092
Alignment:
| Q |
69 |
ataagtattgagtaatagtgtatggtgtcatttttgtgtttgtatttttgtgtttacttatcattcctg |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37606024 |
ataagtattgagtaacagtgtatggtgtcatatttgtgtttgtattattgtgtttacttatcattcctg |
37606092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 94 - 136
Target Start/End: Complemental strand, 30891806 - 30891764
Alignment:
| Q |
94 |
tgtcatttttgtgtttgtatttttgtgtttacttatcattcct |
136 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30891806 |
tgtcgtttttgtgtttgtatttttgtgttcacttatcattcct |
30891764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 69 - 137
Target Start/End: Complemental strand, 31559551 - 31559483
Alignment:
| Q |
69 |
ataagtattgagtaatagtgtatggtgtcatttttgtgtttgtatttttgtgtttacttatcattcctg |
137 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
31559551 |
ataagtattgagtaacagtgtatggtgtcatatttatgtttgtattattgtgtttacttatcattcctg |
31559483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 67 - 133
Target Start/End: Complemental strand, 27656910 - 27656844
Alignment:
| Q |
67 |
atataagtattgagtaatagtgtatggtgtcatttttgtgtttgtatttttgtgtttacttatcatt |
133 |
Q |
| |
|
|||||||||||||| || ||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27656910 |
atataagtattgaggaacagtctatggtatcatttttgtgtttgtatttttgtgtttacttatcatt |
27656844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 33602528 - 33602495
Alignment:
| Q |
158 |
aaaaacatatttaatcgtttaatatttcatttca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33602528 |
aaaaacatatttaatcgtttaatatttcatttca |
33602495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 136
Target Start/End: Complemental strand, 7453604 - 7453567
Alignment:
| Q |
99 |
tttttgtgtttgtatttttgtgtttacttatcattcct |
136 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7453604 |
tttttgtgtttgtatttttgtgttcacttatcattcct |
7453567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University