View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_high_35 (Length: 240)
Name: NF15791_high_35
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 32565427 - 32565641
Alignment:
| Q |
9 |
gagaagaatagtattcctttgtctattgaatgtaaaataattattttttcttataaaccaaagaaatttgagtaaatgaaacacaagttgttctcaggtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32565427 |
gagaagaatagtattcctttgtctattgaatgtaaaataattattttttctcataaaccaaagaaatttgagtaaatgaaacacaagttgttctcaggtg |
32565526 |
T |
 |
| Q |
109 |
aagcacacaataaagtagtagatgaaaaaccatgaacttgattcatacacagtgacaagtcttcatcttttgtttaggtcaaaataagtattcatcctta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32565527 |
aagcacacaataaagtagtagatgaaaaaccatgaacttgattcatacacagtgacaagtcttcatcttttgtttaggtcaaaataagtattcatcctta |
32565626 |
T |
 |
| Q |
209 |
tcttaggcaacaagg |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32565627 |
tcttaggcaacaagg |
32565641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University