View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_high_43 (Length: 209)
Name: NF15791_high_43
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 37581185 - 37581001
Alignment:
| Q |
19 |
tgtttgccctttaggaacataggcaatacatggacaaaaacagaacaaaaataaccacaattattgattcc-atgggttttccccgggacgagctgcctc |
117 |
Q |
| |
|
||||||||||| |||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37581185 |
tgtttgcccttcaggaacatgggcaatgcatggacaaaaacaaaacaaaaataaccacaattattgattcccatgggttttccccgggacgagctgcctc |
37581086 |
T |
|
| Q |
118 |
ctcttcattcggctttggactgaagttattctgactgttaaatgtcttgcgaatctcctccggcgtcttccccttgatgatgtcc |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37581085 |
ctcttcgttcggctttggactgaagttattctgactgttaaacgtcttgcgaatctcctccggcgtcttccccttgatcatgtcc |
37581001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 8992611 - 8992563
Alignment:
| Q |
153 |
tgttaaatgtcttgcgaatctcctccggcgtcttccccttgatgatgtc |
201 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
8992611 |
tgttaaaggtcttgcgaatctcctcaggtgtcttccccttgatcatgtc |
8992563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University