View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_15 (Length: 338)
Name: NF15791_low_15
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 74 - 321
Target Start/End: Original strand, 32010128 - 32010375
Alignment:
| Q |
74 |
catcactagagttttaaaatattgatttaatccaatttttcacttataagttatatcaaacactaaatagaacacatctctttatcagaatttaaatttt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32010128 |
catcactagagttttaaaatattgatttaatccaatttttcacttataagttatatcaaacactaaatagaacacatctctttatcagaatttaaatttt |
32010227 |
T |
|
| Q |
174 |
agttcatcagataataaaagtataatttattctgctagattcaaccctatggattggtgatttaatccaaattgcaacaaaaataatatatttatgttga |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32010228 |
agttcatcagataataaaagtataatttattctgctagattcaaccctacggattggtgatttaatccaaattgcaacaaaaataatatatttatgttga |
32010327 |
T |
|
| Q |
274 |
tatgttagtttgnnnnnnnaaaagacaaactagtatagtaatattggt |
321 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32010328 |
tatgttagtttgtttttttaaaagacaaactagtatagtaatattggt |
32010375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University