View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_20 (Length: 325)
Name: NF15791_low_20
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 46236248 - 46236108
Alignment:
| Q |
17 |
catttctttcatcttatctctctttatttcaagttcattaattttctgcttcaaaatttgtacataatttgcagcctcacctatgtgatctgatactgaa |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236248 |
catttctttcattttatctctctttatttcaagttcattaattttctgcttcaaaatttgtacataatttgcagcctcacctatgtgatctgatactgaa |
46236149 |
T |
 |
| Q |
117 |
cgcttaccctaaaagcaaagaaagatgttgtgaaaactacg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236148 |
cgcttaccctaaaagcaaagaaagatgttgtgaaaactacg |
46236108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 239 - 312
Target Start/End: Complemental strand, 46236027 - 46235954
Alignment:
| Q |
239 |
gaccttgatgagatcaaaaggaattgaagaacggagtgatgaacatagaatagacatttgcatcctcctttgct |
312 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236027 |
gaccttgatgagatcaaaaggaagtgaagaacggagtgatgaacatagaatagacatttgcatcctcctttgct |
46235954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University