View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_25 (Length: 298)
Name: NF15791_low_25
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 14 - 138
Target Start/End: Complemental strand, 43672260 - 43672136
Alignment:
| Q |
14 |
gagaagaacgttgtaagatgttgtgtgggttttaaggtttaaggaagtgaagtggttgagaacaaagttagcggtgtcggagttgggtttagttccggcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672260 |
gagaagaacgttgtaagatgttgtgtgggttttaaggtttaaggaaatgaagtggttgagaacaaagttagcggtgtcggagttgggtttagttccggcg |
43672161 |
T |
 |
| Q |
114 |
aggtgagggtgcatggtgagggtgc |
138 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43672160 |
aggtgagggtgcatggtgagggtgc |
43672136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 203 - 278
Target Start/End: Complemental strand, 43672071 - 43671996
Alignment:
| Q |
203 |
gttgtttgaatgtgggggtgtgtgtgggaaatggaaggcgtagaaaccaagaatgcataggattaagaatactacc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672071 |
gttgtttgaatgtgggggtgtgtgtgggaaatggaaggcgtagaaaccaagaatgcataggattaagaatactacc |
43671996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University