View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_26 (Length: 297)
Name: NF15791_low_26
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 148 - 263
Target Start/End: Original strand, 22652 - 22767
Alignment:
| Q |
148 |
tttcaataattaatccctataaagcca-atttactagttgcacaccaattgaacaacaattaatatccaatttaattatcatggaactatttaagctgtt |
246 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
22652 |
tttcaataattaatccctaaaaagccccatttactagttgca-acaaattgaacaacaattaatatccaatttaatgatcatggaactatttaagttgtt |
22750 |
T |
|
| Q |
247 |
cgaattgccaaatttaa |
263 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22751 |
cgaattgccaaatttaa |
22767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University