View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_27 (Length: 297)
Name: NF15791_low_27
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 15 - 297
Target Start/End: Complemental strand, 43672735 - 43672453
Alignment:
| Q |
15 |
gagcagagagtggcatagatggaattttagggaaccttttcaaaacttcattatcatccaaactcaacttctcactaccttcaacactaccccaaccagg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672735 |
gagcagagagtggcatagatggaattttagggaaccttttcaaaacttcattatcatccaaactcaacttctcactaccttcaacactaccccaaccagg |
43672636 |
T |
 |
| Q |
115 |
actaagtgggtcccctacacctttcatcacgtgacctctctcaaacccatcacgccacgtgtcattctcatcattataaaccagaaccgctacagcaccg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43672635 |
actaagtgggtcccctacacctttcatcacgtgacctctctcaaacccattacgccacgtgtcattctcatcattataaactagaaccgctacagcaccg |
43672536 |
T |
 |
| Q |
215 |
ttttcctcagccttttcaaccaccgtgttcctccctaaaccaccaccttttcttactatcactatacatcccttaatgcttac |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43672535 |
ttttcctcagccttttcaaccaccgtgttcctccctaaaccaccaccttttcttactatcactatacatcccttaatgcttac |
43672453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University