View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_32 (Length: 273)
Name: NF15791_low_32
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 37887449 - 37887271
Alignment:
| Q |
13 |
atactatggatatttgttttcttattatttcgatagattataatcttggatcacttacccatagaatttattaatttaaacatctcttttaataaacaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887449 |
atactatggatatttgttttcttattatttcgatagattataatcttggatcacttacccatagaatttattaatttaaacatctcttttaataaacaaa |
37887350 |
T |
|
| Q |
113 |
cttgtagcttaagaatgaggtcgaatgataactatttggtgaaaaatataaattaccgcagtatatggtcacacaaaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37887349 |
cttgtagcttaagaatgaggtcgaatgataactatttggtgaaaaatataaattaccgcagaatatggtcacacaaaaa |
37887271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University