View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_36 (Length: 245)
Name: NF15791_low_36
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 23859632 - 23859396
Alignment:
| Q |
1 |
ttcagctgccatatattgtaatgttgtataattggagtggcatggacatgtaaaaagtcaagaatttgtatattacattgacaggttttgtcaaaatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23859632 |
ttcagctgccatatattgtaatgttgtataattggagtggcatggacatgtaaaaagtcaagaatttgtatattacattgacaggttttgtcaaaatagt |
23859533 |
T |
|
| Q |
101 |
gcctcaaatgaaattaatatccttccttttcctttattcttctagtcttatgatggtgcagttggaatagtttatggtgcagaatctcatggtgagttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23859532 |
gcctcaaatgaaattaatatccttccttttcctttattcttctagtcttatgatggtgcagttggaatagtttatggtgcagaatctcatggtgagttaa |
23859433 |
T |
|
| Q |
201 |
gcttggttttgttattctaggtttcttgtcatatttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23859432 |
gcttggttttgttattctaggtttcttgtcatatttc |
23859396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 119 - 197
Target Start/End: Complemental strand, 8088150 - 8088071
Alignment:
| Q |
119 |
atccttccttttcctttattctt-ctagtcttatgatggtgcagttggaatagtttatggtgcagaatctcatggtgagt |
197 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
8088150 |
atccttctttttcctttattgtttctagtcttatgatggtgggtttggattagttcctggtgcagaatctcatggtgagt |
8088071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University