View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_43 (Length: 238)
Name: NF15791_low_43
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 36957618 - 36957392
Alignment:
| Q |
1 |
tgcaccaaggaatggtatcaagctgaccatactactgcctcaaagatagatgcacattgcacattaccatgcaaatttagatccgcaacatcagccagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36957618 |
tgcaccaaggaatggtatcaagctgaccatact---gcctcaaagatagatgcacattgcacattaccatgcaaatttagatccgcaacatcagccagtt |
36957522 |
T |
 |
| Q |
101 |
gctccattttatatnnnnnnnnnctggttgctcttgctccattatgggtgtatatatacactatatgagtgaaacactaaactatcatgtttctctaaac |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36957521 |
gctccattttatataaaaaaaaactggttgctcttgctccattatgggtgtatatatacactatatgagtgaaacactaaactatcatgtttctctaaac |
36957422 |
T |
 |
| Q |
201 |
tctgttaaattagttcataaaattgatgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36957421 |
tctgttaaattagttcataaaattgatgat |
36957392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University