View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_50 (Length: 207)
Name: NF15791_low_50
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_50 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 51120648 - 51120834
Alignment:
| Q |
21 |
atcttgccaatggattgcgcgctttctctcaaaatgttacaactttgacttcactcacttttttcaacgtaaattatattgatcgcaatgactttttcct |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51120648 |
atcttgccaatggattgcgagctttctctcaaaatgttacaactttgacttcactcacttttttcaacgtaaattatattgatcgcaatgactttttcct |
51120747 |
T |
 |
| Q |
121 |
catcgccgattgttttcccgatttgcagtcgcttggttttaagtaccgccatggaatatgtaacaaaggtattggttgtgttttatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51120748 |
catcgccgattgttttcccgatttgcagtcgcttggttttaagtactgccatggaatatgtaacaaaggtattggttgtgttttatg |
51120834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University