View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15791_low_6 (Length: 471)
Name: NF15791_low_6
Description: NF15791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15791_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 18 - 368
Target Start/End: Original strand, 13429921 - 13430271
Alignment:
| Q |
18 |
aggggaaccatgtaattatgaagcataacatgtttcaaacttgtgaattgtggaattaaaatcctatctttgtcatacaaaaccacttgctagaaaacaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13429921 |
aggggaaccatgtaattctgaagcataacatgtttcaaacttgtcaattgtggaattaaaatcttatctttgtcatacaaaaccacttgctagaaaacaa |
13430020 |
T |
|
| Q |
118 |
acaattatttggaatgctgaaattactagcaaaaactgttaccaccaaatgtgaaacataaaagttctggagttcagtgataatgataggttgataagtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13430021 |
acaattatttggaatgctgaaattactagcaaaaactgttaccaccaaatgtgaaacataaaagttctggagttcagtgataatgataggttgataagtt |
13430120 |
T |
|
| Q |
218 |
gaaatagcagcaaagagatgaccaacgggttggcagcgggacaaaccatcgacaaccacattgcaatgacccgagaagtacaatatttcaaagttgtagc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||| ||||||||||||| ||||| |
|
|
| T |
13430121 |
gaaatagcagcaaagagatgaccaacgggttggcagcgggacaaaccatcgacaaccacatttccatgacctgagaagtaaaatatttcaaagtcgtagc |
13430220 |
T |
|
| Q |
318 |
ccataagttttatcaaccattgttgggttgggatttgtatagtctgattca |
368 |
Q |
| |
|
| | ||||||| |||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
13430221 |
ctagaagttttgtcaatcatcgttgggttgggatttgtatagtttgattca |
13430271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University