View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15792_low_17 (Length: 224)
Name: NF15792_low_17
Description: NF15792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15792_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 1840034 - 1840230
Alignment:
| Q |
15 |
atgaaccaaaccattgatgcaatcgagttcaatttatgaaccacgaacacccttaaattttt-caatacgaagtaattcttgttaaagaatatcttcgaa |
113 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||| ||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1840034 |
atgaatcaaactattaatgcaatcgagttcaatttacgaaccacaaacacccttaaattttttctatacgaagtaattcttgttaaagaatatctttgaa |
1840133 |
T |
|
| Q |
114 |
cactaaatattaatatatctcggtggagattaggaccttaacttgtcggattgttcagggttaattaaccatttatgcatatactcaaccatttttg |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1840134 |
cactaaatattaatatatttcggtggagattaggaccttaacttgtcggattgttcagggttaattaaccatttatgcatatactcaaccatttttg |
1840230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University