View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15792_low_7 (Length: 414)
Name: NF15792_low_7
Description: NF15792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15792_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 221 - 337
Target Start/End: Original strand, 20248673 - 20248790
Alignment:
| Q |
221 |
gtctaccttttcttctggatacaccatccttcttttttatacccataacttcatatgcattgaagttttcatttaaagcaattgttctgtcatcagggtt |
320 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
20248673 |
gtctaccttttcctctggatacaccatccttcttttttatacccataacttcagatgcattgaagttttcattcaaagcaattgttctgtcatcagagtt |
20248772 |
T |
|
| Q |
321 |
-acatcatttgtttgaca |
337 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
20248773 |
aacataatttgtttgaca |
20248790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 335 - 389
Target Start/End: Original strand, 23881375 - 23881429
Alignment:
| Q |
335 |
acagcatagagtacaaacttttataacatatgagatttcaacatgtgtggctaat |
389 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23881375 |
acagcatagagtacaaacttttataacagatgagatttcaacatgtgtggctaat |
23881429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 335 - 398
Target Start/End: Complemental strand, 52610686 - 52610623
Alignment:
| Q |
335 |
acagcatagagtacaaacttttataacatatgagatttcaacatgtgtggctaatgccaataac |
398 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52610686 |
acagcatagagtgcaaacttttataacagatgagatttcaacatgtgtggctaatgccaataac |
52610623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 31331009 - 31330951
Alignment:
| Q |
340 |
atagagtacaaacttttataacatatgagatttcaacatgtgtggctaatgccaataac |
398 |
Q |
| |
|
||||| |||||| |||||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31331009 |
atagattacaaatttttataacagatggaatttcaacacatgtggctaatgccaataac |
31330951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University