View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15794_low_6 (Length: 220)
Name: NF15794_low_6
Description: NF15794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15794_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 13069784 - 13069976
Alignment:
| Q |
15 |
gcataggttgtggtactagtaaaggtctattggggagatgctcgtgagaaattatgtgaagcaattgaacaagtacctcttgatggtcttaccatgggga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13069784 |
gcataggttgtggtactagtaaaggtctattggggagatgctcgtgagaaattatgtgaagcaattgaacaagtacctcttgatggtcttaccatgggga |
13069883 |
T |
|
| Q |
115 |
atagaggtcttggcacccttagaaggtagatataccaccttaacccgaaattgagagtttcannnnnnnnaatgatatttcattgaatatttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13069884 |
atagaggtcttggcacccttagaaggtagatataccaccttaacccgaaattgagagtttcattttttttaatgatatttcattgaatatttt |
13069976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University