View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15795_low_1 (Length: 335)
Name: NF15795_low_1
Description: NF15795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15795_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 23096786 - 23097023
Alignment:
| Q |
19 |
ccgccaaagtcgatgatgactctccttcgttgtactgaaccacgatcagcgccgccgctggttgaagaaccgttgccgtcatgaatggcggtgttagagc |
118 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
23096786 |
ccgccaaagccgatgaagactctccttcgttgtactgaaccacgatcggcgccgccgctggttgaagaaccgttgccgtcataaatggcggcgttggagc |
23096885 |
T |
|
| Q |
119 |
atctaagactgcgttgagtaccccacttcaagattggtaaggtgaaattgtgaagaggtttacgtgttttgggaattggtgagataggttcagtttcttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||| ||| |||||||||||||| |||||||| |
|
|
| T |
23096886 |
atctaagactgcgttgagtaccccacttcaagattggtaaggtgaaattgtgaaggggtttgcgttttttggaaatgggtgagataggttcggtttcttc |
23096985 |
T |
|
| Q |
219 |
g------tcttcttcttcaatacctcgtaaaaccattt |
250 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
23096986 |
gttttcttcttcttcttcaatacctcgtaaaaccattt |
23097023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 23097052 - 23097097
Alignment:
| Q |
279 |
aaacggtggtttttgagaaattgggtttttgtgttgatgatggtga |
324 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23097052 |
aaacagtggtttttgagaaattgggtttttgtgttgatgatggtga |
23097097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University