View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15797_high_5 (Length: 270)
Name: NF15797_high_5
Description: NF15797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15797_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 13510823 - 13511053
Alignment:
| Q |
18 |
gtgattaccgcaataagtgtgaaaaaattgaagaaagagcaagacatatatacaaccatgttggtggaaccctcgccgccactgtcatcgcttgcgttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13510823 |
gtgattaccgcaataagtgtgaaaaaattgaaga----gcaagacatatatacaaccatgttggtggaaccctcaccgccactgtcatcacttgcgttga |
13510918 |
T |
|
| Q |
118 |
cattgaagcaggctgccgcttcactatgtcgcttcaatttagtaatattctacaaatgggatgtagtaannnnnnnaggttatttgcttgattgagggca |
217 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13510919 |
cattgaagcagactgccgcttcactttgtcgcttcaatttagcaatattctacaaatgggatgtagtaatttttttaggttatttgcttgattgagggca |
13511018 |
T |
|
| Q |
218 |
tcagttaaccttgcttcaatttcacatattcagta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13511019 |
tcagttaaccttgcttcaatttcacatattcagta |
13511053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 13600354 - 13600584
Alignment:
| Q |
18 |
gtgattaccgcaataagtgtgaaaaaattgaagaaagagcaagacatatatacaaccatgttggtggaaccctcgccgccactgtcatcgcttgcgttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13600354 |
gtgattaccgcaataagtgtgaaaaaattgaaga----gcaagacatatatacaaccatgttggtggaaccctcaccgccactgtcatcacttgcgttga |
13600449 |
T |
|
| Q |
118 |
cattgaagcaggctgccgcttcactatgtcgcttcaatttagtaatattctacaaatgggatgtagtaannnnnnnaggttatttgcttgattgagggca |
217 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13600450 |
cattgaagcagactgccgcttcactttgtcgcttcaatttagcaatattctacaaatgggatgtagtaatttttttaggttatttgcttgattgagggca |
13600549 |
T |
|
| Q |
218 |
tcagttaaccttgcttcaatttcacatattcagta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13600550 |
tcagttaaccttgcttcaatttcacatattcagta |
13600584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 149 - 252
Target Start/End: Complemental strand, 17585551 - 17585447
Alignment:
| Q |
149 |
cttcaatttagtaatattctacaaatgggatgtagtaannnnnnnaggttatttgcttgattgagggcatcagttaaccttgc-ttcaatttcacatatt |
247 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
17585551 |
cttcaatttaacaatattctatgaatgggatgtggtaatgtttgtaggttattttcttgattgagggcatcagttaaccttgctttcagtttgacatatt |
17585452 |
T |
|
| Q |
248 |
cagta |
252 |
Q |
| |
|
||||| |
|
|
| T |
17585451 |
cagta |
17585447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University