View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15797_low_9 (Length: 227)
Name: NF15797_low_9
Description: NF15797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15797_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 7281150 - 7281341
Alignment:
| Q |
18 |
taaaggaagactcaatttgccagattttagacaaaattaagtgtctctcctattggtagctaaaagcaaaaaatattacttttgcttttgggtatgagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7281150 |
taaaggaagactcaatttgccagattttagacaaaattaattgtctctcctattggtagctaaaagcaaaaaatattacttttgcttttgggtatgagca |
7281249 |
T |
 |
| Q |
118 |
ccggtggtctagtcctttactttgcttaggcaatgggttttagctctctttctcatgtttcattttttgttgtatcattgaaataaacttct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7281250 |
ccggtggtctagtcctttactttgcttaggcaatgggttttagctctctttctcctgtttcattttttgttgtatcattgaaataaacttct |
7281341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University