View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15799_low_4 (Length: 240)
Name: NF15799_low_4
Description: NF15799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15799_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 26 - 225
Target Start/End: Original strand, 7705085 - 7705287
Alignment:
| Q |
26 |
tggacatcatcattgaacattttctcagaactttttacttactgaacagtgccannnnnnnnnnnnnn--gctttctttgttatcttt-ggaatttctag |
122 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
7705085 |
tggacaacatcattgaacattttctcagaactttttacttactgaacagtgccattttttttttctttttgctttctttgttatctttaggagtttctag |
7705184 |
T |
|
| Q |
123 |
cattcttgttgcacacaataaacttcaaaattagttgagattaaacattttagtcaaaacaaattcatagtatgggcacaagataagcaggaagtaaaat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7705185 |
cattcttgttgcacacaataaacttcaaaattagttgagattaaatattttagtcaaaacaaattcatagtatgagcacaagataagcaggaagtaaaat |
7705284 |
T |
|
| Q |
223 |
agt |
225 |
Q |
| |
|
||| |
|
|
| T |
7705285 |
agt |
7705287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University