View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_high_22 (Length: 391)
Name: NF1579_high_22
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 18 - 378
Target Start/End: Original strand, 22734127 - 22734487
Alignment:
| Q |
18 |
ggtacaaatcttccacatacacataccctgcgttgctgcttctctatcaaatgggtttcgatcacttcaatatgaaatgagaaatgggctgttagaaact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22734127 |
ggtacaaatcttccacatacacataccctgcgttgctgcttctctatcaaatgggtttcgatcacttcaatatgaaatgagaaatgggcagttagaaact |
22734226 |
T |
|
| Q |
118 |
tcgaactaaccaccaaactctacttatttgaggcgtgtcggatactaatatggatatatacatctctcggaattcaagtttaggttcaccacattgtggg |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22734227 |
tagaactaaccaccaaactctacttatttgaggcgtgtcggatactaatatggatatatacatctctcggaattcaagtttaggttcaccacattgtggg |
22734326 |
T |
|
| Q |
218 |
tagtttagcacattgcattagactcaacctgcactagaatcaacctcgttggtttgacggaagggtctaaacttctacaacatggcgaactaaggttcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22734327 |
tagtttagcacattgcattagactcaacatgcactagaatcaacctcgttggtttgacggaagggtctaaacttctacaacatggcgaactaaggttcaa |
22734426 |
T |
|
| Q |
318 |
attccgattgagaaaagtaaccatatttgatgtccggcatgcctccaaatataactacttc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22734427 |
attccgattgagaaaagtaaccatatttgatgtccggcatgcctccaaatataactacttc |
22734487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University