View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_high_41 (Length: 283)
Name: NF1579_high_41
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 4289982 - 4289742
Alignment:
| Q |
18 |
tcaaatatcttctcagacaaatccacatctacaagaactctagcatataatccaaacctcttattttgtgtagcttcatctatggtcaagggtgttccaa |
117 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
4289982 |
tcaaatagcttcttagacaaatccacatctactagaactctagcatataatccaaacctcctattttctgtagcttcatctatggtaaagggtgttccaa |
4289883 |
T |
 |
| Q |
118 |
gacatgatgcaatcttatatagggttttccttctccaatattattgtggcaaatgcattaaatgcacccaaatttgagcatgagattgtacctgagtttg |
217 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4289882 |
gacctgatgcaatctcatatagggttttccttctccaatattattgtggcaaatgcaataaacgcacccaaatttgagcatgagattgtgcctgagtttg |
4289783 |
T |
 |
| Q |
218 |
acgcgtaaaattcctaggccggcaaaagaattgcaatatcc |
258 |
Q |
| |
|
| ||||||||| ||||| || || ||||||||||||||||| |
|
|
| T |
4289782 |
aggcgtaaaatccctagtccagcgaaagaattgcaatatcc |
4289742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 201
Target Start/End: Original strand, 22753911 - 22754025
Alignment:
| Q |
87 |
gtagcttcatctatggtcaagggtgttccaagacatgatgcaatcttatatagggttttccttctccaatattattgtggcaaatgcattaaatgcaccc |
186 |
Q |
| |
|
|||||||||||||| |||||||| ||||| | || |||||||||| | ||| || ||| |||||||||||| || || |||||||| || | |||| |
|
|
| T |
22753911 |
gtagcttcatctatagtcaagggggttcccaaaccagatgcaatctcaaataacgtcttctttctccaatattcctgaggtaaatgcatcaatcggaccc |
22754010 |
T |
 |
| Q |
187 |
aaatttgagcatgag |
201 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
22754011 |
aaatttgcgcatgag |
22754025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University