View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_high_51 (Length: 252)
Name: NF1579_high_51
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_high_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 47 - 252
Target Start/End: Original strand, 4308939 - 4309144
Alignment:
| Q |
47 |
aaggaacgtataaattgttaagtatcttaaatatgatatgatatcatggaataatattggattaaaatataaaataaaaacatgggttgtttaagaatta |
146 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4308939 |
aaggaacgtataaattgttaagtattttaaataagatatgatatcatggaataatattggattaaaatataaaataaaaacatgggttgtttaagaatta |
4309038 |
T |
 |
| Q |
147 |
tataannnnnnnnactattggagcaaaatggatatgagtttcataagtatgatgtggcattgaaggaccattgttttagttgtgtatgaaacttaaagta |
246 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
4309039 |
tataattttttttactattggagcaaaatggatatgagtttcataagtatgatgtggcattgaaggaccattgttttagttgtgtatgaaattcaaagta |
4309138 |
T |
 |
| Q |
247 |
ggttcc |
252 |
Q |
| |
|
|||||| |
|
|
| T |
4309139 |
ggttcc |
4309144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 208
Target Start/End: Original strand, 522025 - 522061
Alignment:
| Q |
172 |
aaatggatatgagtttcataagtatgatgtggcattg |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
522025 |
aaatgtatatgagtttcataagtatgatgtggtattg |
522061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University