View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_high_61 (Length: 244)
Name: NF1579_high_61
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1606452 - 1606226
Alignment:
| Q |
1 |
ttacgtaccgttccatgtatcctataaatgggaagctttactaatttggaggatatatagattcttgtttcaaatgggtttctttttcataacgttgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1606452 |
ttacgtaccgttccatgtatcctataaatgggaagctttactaatttggaggatatatagattcttgtttcaaatgggtttctttttcataatgttgtca |
1606353 |
T |
 |
| Q |
101 |
ccattgatgtcaacttttatatgctccataaattaacaaccaaaaagctttcataccaaatttcgaatcgca-nnnnnnnnnggtaggggtcatcaaata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
1606352 |
ccattgatgtcaacttttatatgctccataaattaacaaccaaaaagctttcataccaaatttcgaatcgcattttttttttggtagaggtcatcaaata |
1606253 |
T |
 |
| Q |
200 |
agttacgtacgcatatactactaatta |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1606252 |
agttacgtacgcatatactactaatta |
1606226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University