View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_high_63 (Length: 241)
Name: NF1579_high_63
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 30 - 134
Target Start/End: Complemental strand, 5033422 - 5033318
Alignment:
| Q |
30 |
cttattatacgataatctaagtatatccataaactgaaactttaaagaaatcacattgagaatggtcaccataatgccatatcatacttatgaaactcat |
129 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033422 |
cttattatacgataatccaagcatatccataaactgaaactttaaagaaatcacattgagaatggtcaccataatgccatatcatacttatgaaactcat |
5033323 |
T |
 |
| Q |
130 |
ttatt |
134 |
Q |
| |
|
||||| |
|
|
| T |
5033322 |
ttatt |
5033318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 186 - 232
Target Start/End: Complemental strand, 5033323 - 5033277
Alignment:
| Q |
186 |
tttatttgcatgaaaccaattttattcaaataatacagtagaataat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
5033323 |
tttatttgcatgaaaccaattttattcaaataataccgtagattaat |
5033277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 36790916 - 36790884
Alignment:
| Q |
18 |
aagacgtctcctcttattatacgataatctaag |
50 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
36790916 |
aagacggctcctcttattatacgataatctaag |
36790884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University