View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_high_65 (Length: 232)
Name: NF1579_high_65
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_high_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 31959710 - 31959516
Alignment:
| Q |
1 |
ctgcgtctcttggtttgattggttgtgaggctaattcaccagagacgttgaaaacgtcaccatatttgatgggttcttgctcggagaattgttctgcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31959710 |
ctgcgtctcttggtttgattggttgtgaggctaattcaccagagacgttgaaaacgtcaccatatttgatgggttcttgctcggagaattgctctgcttg |
31959611 |
T |
|
| Q |
101 |
tggtctctgtggctgttcttgactcatgattctgcactttgattttgatgctttacgtttcctagatcgatattgtgtgataatttattgcagtg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959610 |
tggtctctgtggctgttcttgactcatgattctgcactttgattttgatgctttacgtttcctagatcgatattgtgtgataatttattgcagtg |
31959516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 11248026 - 11248075
Alignment:
| Q |
30 |
gctaattcaccagagacgttgaaaacgtcaccatatttgatgggttcttg |
79 |
Q |
| |
|
||||| ||||| ||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
11248026 |
gctaagtcaccggagacattgaaaacttcaccgtatttgatgggttcttg |
11248075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University