View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_low_51 (Length: 278)
Name: NF1579_low_51
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 8337136 - 8337396
Alignment:
| Q |
1 |
aattgttaatggaaatgattctcgagatactttatattttagatgctatggtatatgataaaatcaaattatannnnnnngctttaaatcatttttcatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8337136 |
aattgttaatggaaatgattctcgagatattttatattttagatgttatggtatatgataaaatcaaattatatttttttgctttaaatcatttttcatt |
8337235 |
T |
 |
| Q |
101 |
attttgatttaatattctcgagaaaaaattattctcaagagattttatattttagaagttatggtaaatagtaaaatcaaaatcaaatttgatgttttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8337236 |
attttgatttaatattctcgagaaaaaatgattctcaagagattttatattttagaagttatggtaaatagtaaaatcaaaatcaaatttgatgttttga |
8337335 |
T |
 |
| Q |
201 |
atcatatttcattatttccatttaatgcaaaatatcccttcacaaagactatgctagacac |
261 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8337336 |
atcatttttcattatttccatttaatgcaaaatatcccttcacaaagactatgctatacac |
8337396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University