View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_low_54 (Length: 255)
Name: NF1579_low_54
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_low_54 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 24111374 - 24111616
Alignment:
| Q |
13 |
aatattaataggctttgacatcttagatgctgatttgatgagagtgtctcttgttagaaactgtctaaatcttatctcttatcaatgtcgactttgaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24111374 |
aatattaataggctttgacatcttagatgctgatttgatgagagtgtctcttgttagaaactgtctaaatcttatctcttatcaatgtcgactttgaaaa |
24111473 |
T |
 |
| Q |
113 |
ttttccaatagtcgtagaaaaaatttgtgtgctgttcagtgcatgtatatggtttaattttgtgtcattattacttccaactttaatgtaagatacaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24111474 |
ttttccaatagtcgtagaaaaaatttgtgtgctgttcactgcatgtatatgatttaattttgtgtcattattacttccaactttaatgtaagatacaaaa |
24111573 |
T |
 |
| Q |
213 |
ttcaggtttttattccaaaagttaaaacttgttcatatatatt |
255 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24111574 |
ttcagctttttattccaaaagttaaaacttgttcatatatatt |
24111616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University