View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_low_64 (Length: 246)
Name: NF1579_low_64
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 50731991 - 50732191
Alignment:
| Q |
19 |
caatcctctctcgtaaatgcaggtactcttctcttcccttcattctctcaacattcactcgttcttcgttaactctatctttcgccgcgaagtgttgtgg |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50731991 |
caatcctctctcgtcaatgcaggtactcttctcttcccttcattctctcaacattcactcgttcttcgttaactctatctttcgccgcgaagtgttgtga |
50732090 |
T |
|
| Q |
119 |
aactcgtatgaagtatttcttgaaccctag-------nnnnnnnnngtaattggattgtgattacacggttgcgacttttattatctcgtttgtgttgtg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50732091 |
aactcgtatgaagtatttcttgaaccctagttttttttttttttttgtaattggattgtgattacacggttgcgacttttattatctcgtttgtgttgtg |
50732190 |
T |
|
| Q |
212 |
g |
212 |
Q |
| |
|
| |
|
|
| T |
50732191 |
g |
50732191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University