View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_low_66 (Length: 244)
Name: NF1579_low_66
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 89 - 235
Target Start/End: Original strand, 25941343 - 25941489
Alignment:
| Q |
89 |
gaggggtttctgggatcatggcatccagggacagttattgatagtgagaagctgaagcgtcatgttcaatatgagaatattctgaatgataatggattgg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25941343 |
gaggggtttctgggatcatggcatccagggacagttattgatagtgagaagctgaagcgtcatgttcaatatgagaatattctgaatgataatggattgg |
25941442 |
T |
|
| Q |
189 |
gtaattttgtggagatagtgagtgtttcaagtgttttggatgatgat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25941443 |
gtaattttgtggagatagtgagtgtttcaagtgttttggatggtgat |
25941489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University