View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1579_low_74 (Length: 227)
Name: NF1579_low_74
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1579_low_74 |
 | |
|
| [»] scaffold0224 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0224 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0224
Description:
Target: scaffold0224; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 17499 - 17301
Alignment:
| Q |
13 |
caagaatattaagtaatagtttagttttagaaatggattgtaacatttaacaaagatgaaggagtcattgtctattctatatgacttgtgtgtggactct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17499 |
caagaatattaagtaatagtttagttttagaaatggattgcaacatttaacaaagatgaaggagtcattgtctattctatatgacttgtgtgtggactct |
17400 |
T |
|
| Q |
113 |
agattctctcataaaggtataatacaattactgccaaatttttaggctatttgtactagtataattttttcgcattgccactaattttgaggttaaaac |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17399 |
agattctctcataagggtataatacaattactgccaaatttttaggctatttgtactagtataattttttcgcattgccactaattttgaggttgaaac |
17301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 211
Target Start/End: Original strand, 42920832 - 42921030
Alignment:
| Q |
13 |
caagaatattaagtaatagtttagttttagaaatggattgtaacatttaacaaagatgaaggagtcattgtctattctatatgacttgtgtgtggactct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42920832 |
caagaatattaagtaatagtttagttttagaaatggattgcaacatttaacaaagatgaaggagtcattgtctattctatatgacttgtgtgtggactct |
42920931 |
T |
|
| Q |
113 |
agattctctcataaaggtataatacaattactgccaaatttttaggctatttgtactagtataattttttcgcattgccactaattttgaggttaaaac |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42920932 |
agattctctcataagggtataatacaattactgccaaatttttaggctatttgtactagtataattttttcgcattgccactaattttgaggttgaaac |
42921030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University