View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15800_low_12 (Length: 262)
Name: NF15800_low_12
Description: NF15800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15800_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 14918706 - 14918957
Alignment:
| Q |
1 |
ctttttggctttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14918706 |
ctttttggttttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatct |
14918805 |
T |
 |
| Q |
101 |
tctactcttttttccgatgatgatcatttcagttgagctttatttttgaagtcgcatgattgttgcttctttgctgcgatcaaatgtgta-tatatgttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
14918806 |
tctactcttttttccgatgatgatcatttcagttgagctttatttttgaagttacatgattgttgcttcttttctgcgatcaaatgtgtattatatgttc |
14918905 |
T |
 |
| Q |
200 |
ttttagatgccttgacattttttcttatatgacatgtgcgtattcatctctc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
14918906 |
ttttagatgccttgacattttttcttatatgccatgtgcgtattcatgtctc |
14918957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 38126288 - 38126443
Alignment:
| Q |
1 |
ctttttggctttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
38126288 |
ctttttggtattgcaggaactgttgtggacagcaaaatttgccatcctaggaattatgatttttatatgtgtgctcatgctggaatgattgtgagtatct |
38126387 |
T |
 |
| Q |
101 |
tctactcttttttccgatgatgatcatttcagttgagctttatttttgaagtcgcat |
157 |
Q |
| |
|
||||||| |||||| ||||||| ||||||||| ||||||| |||||||||| |||| |
|
|
| T |
38126388 |
tctactc-tttttctgatgatgttcatttcagctgagcttgctttttgaagttgcat |
38126443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 2 - 112
Target Start/End: Original strand, 38118171 - 38118281
Alignment:
| Q |
2 |
tttttggctttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatctt |
101 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||||| |||||| ||||||| |||| |||||||||||||| |
|
|
| T |
38118171 |
tttttggttttgcaggtactgttgtggacaacaaaatctgtcatccccggaattatgatttctacatgtgtgctcatgctggaatgattgtgagtatctt |
38118270 |
T |
 |
| Q |
102 |
ctactcttttt |
112 |
Q |
| |
|
||||||||||| |
|
|
| T |
38118271 |
ctactcttttt |
38118281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 35469009 - 35469064
Alignment:
| Q |
10 |
tttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttcta |
65 |
Q |
| |
|
||||||||||||||| | ||||| |||||||||||||| || || ||||||||||| |
|
|
| T |
35469009 |
tttgcaggaactgttatcgacaataaaatttgtcatccaagaaactatgatttcta |
35469064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University