View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15800_low_13 (Length: 261)
Name: NF15800_low_13
Description: NF15800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15800_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 28 - 237
Target Start/End: Original strand, 34934470 - 34934674
Alignment:
| Q |
28 |
ggcacacgagaaaggacttttaagtttcaacaacttaatgccctattttggtcacaagcttctattaccaaattcggaatgtaaattttattttattcca |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
34934470 |
ggcacacgagaaaggacttttaagtttcaacaacttaatgccctattttggtcacaagcttctgttaccaaattcggaatgtaaattt-----tattcca |
34934564 |
T |
 |
| Q |
128 |
cctcatctaatttcgatagatattatataaaaaagattaaccaactctcaaaatttttaacggttgtttcaattttattggattacactttttccgtttc |
227 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34934565 |
cctgatctaatttcgatagatattatataaaaaagattaaccaactctcaaaaattttaacggttgtttcaattttattggattacactttttccgtttc |
34934664 |
T |
 |
| Q |
228 |
catccgattt |
237 |
Q |
| |
|
|||||||||| |
|
|
| T |
34934665 |
catccgattt |
34934674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University