View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15800_low_18 (Length: 209)
Name: NF15800_low_18
Description: NF15800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15800_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 36 - 199
Target Start/End: Original strand, 34935525 - 34935683
Alignment:
| Q |
36 |
aaaacattattccttgatttattcgcatgtttcaactcagacaaaaccttaacctaaccggtcgcaacagctttatgggatgggatgaccaccggcggct |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34935525 |
aaaacattattccttgatttattcgcatgtttcaactcagacaaaaccttaacctaaccggtcgcaacagcttt-----atgggatgaccaccggcggct |
34935619 |
T |
|
| Q |
136 |
cgcaatgaaaagaaagagaaacgactctctcaattcttcagatgattttgacttacctgatgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34935620 |
cgcaatgaaaagaaagagaaacgactctctcaattcttcagatgattttgatttacctgatgat |
34935683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University