View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15802_high_1 (Length: 304)
Name: NF15802_high_1
Description: NF15802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15802_high_1 |
 |  |
|
| [»] scaffold0775 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0775 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 2318 - 2037
Alignment:
| Q |
18 |
ggttcctctcagttataaatttcgttatgaatatatttgtctgaaattcataattgtgataagatccctttacaaaactagccatgagtttaagccctac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
2318 |
ggttcctctcagttataaatttcgttatgaatatatttgtctgaaattcataattgtgataagatccctttacaaaactagctatgaatttaagccctac |
2219 |
T |
 |
| Q |
118 |
gtaaaagacttttccgttgttacatactttctaaccaaatgtttaaaaatagtattccattgttggggatgggaaaataatttatgtccacggtatttgc |
217 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2218 |
gtaaaagatttttcggttgttacatactttctaaccaaatgtttaaaaatagtattccattgttggggatggtaaaataatttatgtccacggtatttgc |
2119 |
T |
 |
| Q |
218 |
ggataaaatctgtcagagacacaagacactagtttaatggatactagtgattggacgtttttatttctaagaagaataatct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2118 |
ggataaaatctgtcagagacacaagacactagtttaatggatactagtgattggacgtttttatttctaagaagattaatct |
2037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University