View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15803_high_7 (Length: 261)
Name: NF15803_high_7
Description: NF15803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15803_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 13 - 260
Target Start/End: Complemental strand, 52584499 - 52584252
Alignment:
| Q |
13 |
aatattgggctagcacaaggttctgagatgagtcacacaagacatttgatggatctacttggtgcagcaaacgagaataatcaccagacacaacaaggcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584499 |
aatattgggctagcacaaggttctgagatgagtcacacaagacatttgatggatctacttggtgcagcaaacgagaataatcaccagacacaacaaggcc |
52584400 |
T |
|
| Q |
113 |
tatccctttctttaggctctcacatgcttgttgatgaatacagaaaccgttccttaaatcaaggtcttatgatcaatccaagttacttcatgcctggtca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584399 |
tatccctttctttaggctctcacatgcttgttgatgaatacagaaaccgttccttaaatcaaggtcttatgatcaatccaagttacttcatgcctggtca |
52584300 |
T |
|
| Q |
213 |
agatcagacacgtgagccttgtaatcaacctgtggtggagaatctaac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584299 |
agatcagacacgtgagccttgtaatcaacctgtggtggagaatctaac |
52584252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University