View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15803_low_10 (Length: 223)

Name: NF15803_low_10
Description: NF15803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15803_low_10
NF15803_low_10
[»] chr3 (2 HSPs)
chr3 (14-98)||(46453638-46453722)
chr3 (136-206)||(46453760-46453830)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 14 - 98
Target Start/End: Original strand, 46453638 - 46453722
Alignment:
14 aaaatactccattgagaatgaatgataatacaaaatgatagttaaaaaattgacgcatgtaaactaaatttaacgacataaattg 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46453638 aaaatactccattgagaatgaatgataatacaaaatgatagttaaaaaattgacgcatgtaaactaaatttaacgacataaattg 46453722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 136 - 206
Target Start/End: Original strand, 46453760 - 46453830
Alignment:
136 ggaggaagtaatcattatcaaagaataattgctagttccaatgagatcgacaaaatacaatcagcaaaaca 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
46453760 ggaggaagtaatcattatcaaagaataattgctagttccaatgagatcgacaaaatacattcagcaaaaca 46453830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University