View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15803_low_6 (Length: 325)
Name: NF15803_low_6
Description: NF15803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15803_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 16 - 323
Target Start/End: Complemental strand, 24781974 - 24781667
Alignment:
| Q |
16 |
gtatcatcgacctcgccggaaaccgtttctccggtaatatcccctctgatatcggcaaactccgccatctcaaccgtcttagcatcgccgacaatgtcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
24781974 |
gtatcatcgacctcgccggaaaccgtttctccggtaatatcccctctgatatcggcaaactccgccatctcaaccgtctcagcatcgccgacaacgtcat |
24781875 |
T |
|
| Q |
116 |
caccggtggaatcccactgtccataaccaacctgactagtttgactcatcttgacatccgtaataataggatctcaggatatatcccaatgggctttggc |
215 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781874 |
caccggtggaatccccaggtccttaaccaacctaactagcttgactcatcttgacatccgtaataataggatctcaggatatatcccaatgggctttggc |
24781775 |
T |
|
| Q |
216 |
aggcttcagtatttaggccgggctttattaagtggtaatcagttacacgggcccatccccggctcaatatctcgaatcaaacgtctttcggatcttcatc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24781774 |
aggcttcagtatttaggccgggctttattaagtggtaatcagttacacgggcccatccccggctcaatatctcgaatcaaacgtctttcggatcttgatc |
24781675 |
T |
|
| Q |
316 |
tctctcga |
323 |
Q |
| |
|
| |||||| |
|
|
| T |
24781674 |
tatctcga |
24781667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University