View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15804_high_33 (Length: 232)
Name: NF15804_high_33
Description: NF15804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15804_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 42725322 - 42725106
Alignment:
| Q |
1 |
caattagtcaaacattatctgcactatttggcacctgtccaccagaatatcagaagccatcaggtcaatcccgcaaaccattttctgcgtcataatatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42725322 |
caattagtcaaacattatctgcactatttggcacctgtccaccagaataacagaagccatcaggtcaatcccgcaaaccattttctgcgtcataatatat |
42725223 |
T |
 |
| Q |
101 |
ttggctatcatgaatcatgggagccttgaaccatcaaagtaatacgcttagcactgtctgcacgaaagttgtcccctttgaaggaaacctgaaagtacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42725222 |
ttggctatcatgaatcatgggagccttgaaccatcaaagtaatacgcttagcactgtctgcacgaaagttgtcccctttgaaggaaacctgaaagtacaa |
42725123 |
T |
 |
| Q |
201 |
tcacattcaatatcctt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42725122 |
tcacattcaatatcctt |
42725106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University