View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15804_high_35 (Length: 219)

Name: NF15804_high_35
Description: NF15804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15804_high_35
NF15804_high_35
[»] chr8 (1 HSPs)
chr8 (15-200)||(41784554-41784739)


Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 41784554 - 41784739
Alignment:
15 atgaagcgtctatgcaaagagatgacttgatggagaagcttaacgttatgcaacaaaagttagattctatagagaatcataacaaagaattagaagctca 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41784554 atgaagcgtctatgcaaagagatgacttgatggagaagcttaacgttatgcaacaaaagttagattctatagagaatcataacaaagaattagaagctca 41784653  T
115 gttggaaagaaaagcagaagaaatatcccagttcctaattcagatggaaaatttaaaggagaatttagccgaaatgaaatcaaccg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41784654 gttggaaagaaaagcagaagaaatatcccagttcctaattcagatggaaaatttaaaggagaatttagccgaaatgaaatcaaccg 41784739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University