View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15804_low_15 (Length: 398)
Name: NF15804_low_15
Description: NF15804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15804_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 14 - 380
Target Start/End: Complemental strand, 49989404 - 49989038
Alignment:
| Q |
14 |
caaaggcaaagaaagtcttcacctctttggacatctgtcctgtttttagatttgacacgagattggctctttggaagaagaacaccatcacgggagacac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49989404 |
caaaggcaaagaaagtcttcacctctttggacatctgtcctgtttttagattttagacgagattggctctttggaagaagaacaccatcacgggagacac |
49989305 |
T |
 |
| Q |
114 |
tcaactttacatctgcaccggaatgcactagaatattttgaaatgatggttttacaagcatcccgtaaacaagaaaaacctgcccagaagccggcttctg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49989304 |
tcaactttacatctgcaccggaatgcactggaatattttgaaatgatggttttacaagcatcccgtaaacaagaaaaacctgcccagaagccggcttctg |
49989205 |
T |
 |
| Q |
214 |
ggtgttttgtaagtttgcagcgtatattgcggggagtgcacccttgtaattttttgtggacatgtcttccgaagataatgagattttcgttggttttgca |
313 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49989204 |
ggtgctttgtaagtttgcagcatatattgcggggagtgcacccttgtaattttttgtggacatgtcttccgaagataatgagattttcgtgggttttgca |
49989105 |
T |
 |
| Q |
314 |
tttcgtagttcttcaatactatttccaaaccataaataacaaagaccagcttctgatatggccaaaa |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49989104 |
tttcgtagttcttcaatactatttccaaaccataaataacaaagaccagcttctgatatggccaaaa |
49989038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University