View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15805_high_6 (Length: 411)
Name: NF15805_high_6
Description: NF15805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15805_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 103 - 313
Target Start/End: Original strand, 45109569 - 45109779
Alignment:
| Q |
103 |
gaattggagaagagacttacagaggaatagaatggaatggattggattggattggatctaggtagctatgactttgaatggaagtgaaatccgtgggatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45109569 |
gaattggagaagagacttacagaggaatggaatggaatggattggattggattggatctaggtagctatgactttgaatggaagtgaaatccgtgggatt |
45109668 |
T |
 |
| Q |
203 |
cggaattaggaaagaagaaagaagagacaaatggaaaataattgaaaatgtgggttttgattggtgttgtaataataacagtcaaacacaaacacaaaca |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45109669 |
cggaattaggaaagaagaaagaagagacaaatggaaaataattgaaaatgtgggttttgattggtgttgtaattataacagtcaaacacaaacacaaaca |
45109768 |
T |
 |
| Q |
303 |
tctatgtctaa |
313 |
Q |
| |
|
||||||||||| |
|
|
| T |
45109769 |
tctatgtctaa |
45109779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 45109486 - 45109530
Alignment:
| Q |
20 |
ggtcagattttccacaagttatagacaaattaattattatagagt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45109486 |
ggtcagattttccacaagttatagacaaattaattattatagagt |
45109530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University